Galaxy History ' TnSeq analysis'


DatasetAnnotation
1: 100BR1.R1.fastq
2.7 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1392:2171 1:N:0:CGCGCG
NAACCTAAGAAAGTAAAAGAAAAATTATGGAACAATTATTAAGTTTATTCG
+
#1=BDFDBFFFBHAFHGGIIIJIIJJIGIFCGHIGHIHEHIJIGIJFIJIJ
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1352:2212 1:N:0:CGCGCG
TGCCCGTACTTTCTTCGAGGAACTGGACATCGACTCTGTCACTGTAGCTCC
2: 100BR2.R1.fastq
2.7 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1362:2191 1:N:0:AGAGAG
NGTACAACAAGACTACGTATAACCCGCAAGCAGGTCTTGGCGATCTGTCGG
+
#1:BDFFFHHHGHJIJJFGIJJJJJJJJIIIHGIGGEI99?@FHHIIHGHG
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1410:2241 1:N:0:AGAGAG
AAGTAGCTCTCGAAACTCTCAGAAATGTAAAAAAGTTCTTTTTGGAAGCTA
3: 175BR1.R1.fastq
2.6 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1455:2156 1:N:0:TCTCTC
NATCGTAATGAACTCCAAACAGACGGGGGCAGACGTGAACTTTGCCTATCC
+
#11ADAA:?A:4CCC<??<F?;?A@GIIIIB@HA@CHE7?=7;?B?7)6@C
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1935:2206 1:N:0:TCTCTC
ATAAACAAGATACGGAAAAAGAGATTTTCTCGGCATTGTATGCTTCGAAAC
4: 175BR2.R1.fastq
3.1 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1422:2195 1:N:0:GCGCGC
CAGTCCTTACCCCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCAAGCC
+
=?@DDDDD?:+2C@GIGIIIFCBBBBBBB######################
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1371:2246 1:N:0:GCGCGC
TCTCTTCTCCGACGCTTCTTGACCGGGAATTTGGAAAATGCAGAAATACCT
5: L1R1.R1.fastq
2.4 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1960:2192 1:N:0:TTTTTT
NTGTCACCTGGCAACAAGATATAACCGATCTTTATCCGTTGCTTGAAGGCG
+
#1=DDFFFHHHHHJJJJIJJJJJJJJIHIHJIJIIHJIHGJJJII;FHIIJ
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1817:2204 1:N:0:TTTTTT
TGGTTCTCAAGCGATGGGCGGAGTTATCAACATCATTACGCGTAAAGCCAA
6: L1R2.R1.fastq
2.7 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1720:2184 1:N:0:GTGTGT
NGCTTTTGCATTTCACCACAGATCCCCCCCCCCCCCCCCCCCGGCCGGAAC
+
#1=DDDDDHHHHHIIHIIIGIAE:FFGIHIIIIEBBB@#############
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1523:2189 1:N:0:GTGTGT
NAAAGACTCTCGACATAGATCCTGCATATGCAGAAGCATGCTCTAATTTAG
7: L2R1.R1.fastq
2.7 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1659:2194 1:N:0:CTCTCT
TTACGCCAACGATATAAATCGATATTATCTAATGGCACTCCTCCGCCTTCA
+
@@@D1@?@FDFFDFGFIBBHAC81@9*:?9DGFDB3FAG99D;B#######
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1797:2176 1:N:0:CTCTCT
NATCTATGACGGGCCGGAGAAAGAGACAGTCACCGTGATTTCGGGAGCATA
8: L2R2.R1.fastq
2.7 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1622:2164 1:N:0:ATATAT
NATTGGCTTCCATGCTTCGTATTCCGGTTTGCATGCATAATGTAGAAGAAG
+
#1=DDFFFHFHHHJIJJJJGGIIIJIJHIJIJIJJJGJEGGGGGGHIEDGA
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1588:2223 1:N:0:ATATAT
GGATCCTGATCTGGAAGAAGCAATGAAAGCTGCTGTTAAGTCTCCGAATCA
9: NBR1.R1.fastq
2.8 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1507:2215 1:N:0:TGTGTG
TGCACAAGTACTGGCGTCTATTCCGGCTATCCAAAAGAGTATCCGTGAAGC
+
CC@FFFFFHHHHHJJJIIIIJJJJJJJJIIJJIJJIIHJBFHIIIGIDHII
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1527:2224 1:N:0:TGTGTG
CGACTCTCTGTTGGTTGCCGATCCGATTGACCACTTGCTGACTTCGGACCC
10: NBR2.R1.fastq
3.3 Gb
format: fastqsanger, database: ?
Info: uploaded fastqsanger file
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1460:2174 1:N:0:GGGGGG
NGACTACGAAGGCGTTGCCCTCTTCGGAGACAAACTGATTGCCAAACGCCA
+
#1=DDFFFHHGHHIIJJJJJJJIJJJJGIJIJJJJJIIGIJJJIIGGIJJH
@DGL9ZZQ1:354:D1P6JACXX:5:1101:1544:2186 1:N:0:GGGGGG
NCTATCTCCGTCTGTGGGACGATAAAGATAACGAGATCGGTTACGGAGAGT
12: NC_016776.gb.genbank
54,607 lines
format: txt, database: ?
Info: uploaded txt file
LOCUS NC_016776 5373121 bp DNA circular BCT 27-SEP-2012
DEFINITION Bacteroides fragilis 638R, complete genome.
ACCESSION NC_016776
VERSION NC_016776.1 GI:375356399
DBLINK Project: 84217
BioProject: PRJNA84217